shrna lentiviral vectors  (Genechem)

Journal: eLife

Article Title: An altered cell-specific subcellular distribution of translesion synthesis DNA polymerase kappa (POLK) in aging mouse neurons

doi: 10.7554/eLife.101533

Figure Lengend Snippet: ( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual shPOLK lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .

Article Snippet: In addition, N2a cells were transduced with lentiviral vectors expressing shPolk (Cat No. TL502663V, Origene, which have four unique 29mer target-specific shRNAs sequences are 5′ → 3′′, TL502663VA: AGCCATGCCAGGATTTATTGCTAAGAGGC , TL502663VB: CCAGGATTTATTGCTAAGAGGCTCTGCC , TL502663VC: AATCGCAGCAAAGAGGAATGTCCTGATAT , TL502663VD: GGAGCTGCTAAGGACAGAAGTTAATGTGG ) or scrambled shRNA (Cat No. TR30021V, Origene, sequences are 5′ → 3′′ GCACTACCAGAGCTAACTCAGATAGTACT ) for 8 hr, followed by replacement with complete media.

Techniques: Sequencing, Control, Western Blot, Immunofluorescence, Staining, Quantitation Assay, Expressing

Journal: Frontiers in Cellular Neuroscience

Article Title: CircFRRS1 drives neuroinflammation through the miR-27a-3p/TLR4 pathway after deep hypothermic circulatory arrest

doi: 10.3389/fncel.2026.1750887

Figure Lengend Snippet: Inhibition of circFRRS1 alleviates the inflammation damage of PC-12 cells after H-OGD/R treatment. (A) Sequence diagram of circFRRS1. (B) The inhibition effects of si-circFRRS1 were detected by RT-PCR. (C) CCK8 assay revealed circFRRS1 inhibition improved the survival rate of H-OGD/R treated PC-12 cells. (D–F) The inhibition of circFRRS1 reduced the increasing level of TNF-α, IL-6, and IL-1β induced by H-OGD/R treatment. (G) The inhibition of circFRRS1 alleviated the NLRP3 inflammasome activation of H-OGD/R treated PC-12 cells. *** p < 0.001, vs. si-NC group; ## p < 0.01, ### p < 0.001, vs. H-OGD/R + si-NC group.

Article Snippet: The shRNA lentiviral vectors targeting circFRRS1 (sh-circFRRS1) and the negative control (sh-NC) were obtained from Genechem (Shanghai, China).

Techniques: Inhibition, Sequencing, Reverse Transcription Polymerase Chain Reaction, CCK-8 Assay, Activation Assay

Journal: Frontiers in Cellular Neuroscience

Article Title: CircFRRS1 drives neuroinflammation through the miR-27a-3p/TLR4 pathway after deep hypothermic circulatory arrest

doi: 10.3389/fncel.2026.1750887

Figure Lengend Snippet: Dual luciferase reporter experiment confirmed the regulatory relationships of circFRRS1/rno-miR-27a-3p and rno-miR-27a-3p/TLR4 pairs. (A) The predicting binding site between circFRRS1 and miR-27a-3p. (B) Dual luciferase reporter assay revealed that miR-27a-3p attenuated the luciferase activity of circFRRS1-WT, but not of circFRRS1-MUT. (C) The predicting binding site between TLR4 and miR-27a-3p. (D) Dual luciferase reporter assay revealed that miR-27a-3p attenuated the luciferase activity of TLR4 3’-WT, but not of TLR4 3’-MUT. ** p < 0.01, *** p < 0.001, vs. control group; # p < 0.05, ### p < 0.001, vs. WT group.

Article Snippet: The shRNA lentiviral vectors targeting circFRRS1 (sh-circFRRS1) and the negative control (sh-NC) were obtained from Genechem (Shanghai, China).

Techniques: Luciferase, Binding Assay, Reporter Assay, Activity Assay, Control

Journal: Frontiers in Cellular Neuroscience

Article Title: CircFRRS1 drives neuroinflammation through the miR-27a-3p/TLR4 pathway after deep hypothermic circulatory arrest

doi: 10.3389/fncel.2026.1750887

Figure Lengend Snippet: The inhibition of circFRRS1 suppressed TLR4/NF-κB/NLRP3 pathway in H-OGD/R-induced PC-12 cells. (A) WB analysis revealed that the TLR4/NF-κB/NLRP3 axis was activated in H-OGD/R-induced PC-12 cells and markedly inhibited after si-circFRRS1 transfected. (B–G) Statistical analysis of WB results. * p < 0.05; ** p < 0.01, *** p < 0.001, vs. si-NC group; # p < 0.05, ## p < 0.01, vs. H-OGD/R + si-NC group.

Article Snippet: The shRNA lentiviral vectors targeting circFRRS1 (sh-circFRRS1) and the negative control (sh-NC) were obtained from Genechem (Shanghai, China).

Techniques: Inhibition, Transfection

Journal: Frontiers in Cellular Neuroscience

Article Title: CircFRRS1 drives neuroinflammation through the miR-27a-3p/TLR4 pathway after deep hypothermic circulatory arrest

doi: 10.3389/fncel.2026.1750887

Figure Lengend Snippet: circFRRS1 can regulate TLR4 by targeting miR-27a-3p. (A) Administration of miR-27a-3p inhibitor could reverse the downregulation of TLR4 expression by transfecting si-circFRRS1. (B) Further protein-level detection using WB gave the further validation. *** p < 0.001, vs. si-NC group; # p < 0.05, ## p < 0.01, ### p < 0.001, vs. H-OGD/R + si-NC group or H-OGD/R + si-circ group.

Article Snippet: The shRNA lentiviral vectors targeting circFRRS1 (sh-circFRRS1) and the negative control (sh-NC) were obtained from Genechem (Shanghai, China).

Techniques: Expressing, Biomarker Discovery