Journal: eLife
Article Title: An altered cell-specific subcellular distribution of translesion synthesis DNA polymerase kappa (POLK) in aging mouse neurons
doi: 10.7554/eLife.101533
Figure Lengend Snippet: ( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual shPOLK lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .
Article Snippet: In addition, N2a cells were transduced with lentiviral vectors expressing shPolk (Cat No. TL502663V, Origene, which have four unique 29mer target-specific shRNAs sequences are 5′ → 3′′, TL502663VA: AGCCATGCCAGGATTTATTGCTAAGAGGC , TL502663VB: CCAGGATTTATTGCTAAGAGGCTCTGCC , TL502663VC: AATCGCAGCAAAGAGGAATGTCCTGATAT , TL502663VD: GGAGCTGCTAAGGACAGAAGTTAATGTGG ) or scrambled shRNA (Cat No. TR30021V, Origene, sequences are 5′ → 3′′ GCACTACCAGAGCTAACTCAGATAGTACT ) for 8 hr, followed by replacement with complete media.
Techniques: Sequencing, Control, Western Blot, Immunofluorescence, Staining, Quantitation Assay, Expressing